capionist be welcome to help this video translate to other language have a nice day, here's the whole scripts in Google docs: bit.ly/3ztdfQ5

‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎‎

ꜱᴜᴘᴘᴏʀᴛᴇᴅ ʙʏ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎

ꜱᴜᴘᴘᴏʀᴛᴇᴅ ʙʏ ‏‏‎ ‎ 𝗣𝗿𝗼𝘁𝗼𝗰𝗼𝗹 𝗟𝗮𝗯𝘀 ‏‏‎ ‎

ꜱᴜᴘᴘᴏʀᴛᴇᴅ ʙʏ 𝗣𝗿𝗼𝘁𝗼𝗰𝗼𝗹 𝗟𝗮𝗯𝘀 ‏‏‎ ‎ ‏‏‎ ‎

ꜱᴜᴘᴘᴏʀᴛᴇᴅ ʙʏ 𝗣𝗿𝗼𝘁𝗼𝗰𝗼𝗹 𝗟𝗮𝗯𝘀 ᶠᵒˡˡᵒʷ ʸᵒᵘʳ ᶜᵘʳⁱᵒᵘˢˡʸ ‏‏‎ ‎

ꜱᴜᴘᴘᴏʀᴛᴇᴅ ʙʏ 𝗣𝗿𝗼𝘁𝗼𝗰𝗼𝗹 𝗟𝗮𝗯𝘀 ᶠᵒˡˡᵒʷ ʸᵒᵘʳ ᶜᵘʳⁱᵒᵘˢˡʸ ˡᵉᵃᵈ ʰᵘᵐᵃⁿᶦᵗʸ ᶠᵒʳʷᵃʳᵈ

ꜱᴜᴘᴘᴏʀᴛᴇᴅ ʙʏ ‏‏‎ ‎ ᶠᵒˡˡᵒʷ ʸᵒᵘʳ ᶜᵘʳⁱᵒᵘˢˡʸ ˡᵉᵃᵈ ʰᵘᵐᵃⁿᶦᵗʸ ᶠᵒʳʷᵃʳᵈ

ꜱᴜᴘᴘᴏʀᴛᴇᴅ ʙʏ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎

𝔄𝔫𝔶 𝔰𝔲𝔣𝔣𝔦𝔠𝔦𝔢𝔫𝔱𝔩𝔶 𝔞𝔡𝔳𝔞𝔫𝔠𝔢𝔡 𝔱𝔢𝔠𝔥𝔫𝔬𝔩𝔬𝔤𝔶 ‏‏‎ ‎ ‏‏‎ ‎

𝔄𝔫𝔶 𝔰𝔲𝔣𝔣𝔦𝔠𝔦𝔢𝔫𝔱𝔩𝔶 𝔞𝔡𝔳𝔞𝔫𝔠𝔢𝔡 𝔱𝔢𝔠𝔥𝔫𝔬𝔩𝔬𝔤𝔶 𝔦𝔰 𝔦𝔫𝔡𝔦𝔰𝔱𝔦𝔫𝔤𝔲𝔦𝔰𝔥𝔞𝔟𝔩𝔢 𝔣𝔯𝔬𝔪 𝔪𝔞𝔤𝔦𝔠. ‏‏‎ ‎

𝔄𝔫𝔶 𝔰𝔲𝔣𝔣𝔦𝔠𝔦𝔢𝔫𝔱𝔩𝔶 𝔞𝔡𝔳𝔞𝔫𝔠𝔢𝔡 𝔱𝔢𝔠𝔥𝔫𝔬𝔩𝔬𝔤𝔶 𝔦𝔰 𝔦𝔫𝔡𝔦𝔰𝔱𝔦𝔫𝔤𝔲𝔦𝔰𝔥𝔞𝔟𝔩𝔢 𝔣𝔯𝔬𝔪 𝔪𝔞𝔤𝔦𝔠. 𝐀𝐑𝐓𝐇𝐔𝐑 𝐂. 𝐂𝐋𝐀𝐑𝐊𝐄

𝗜𝗻 𝘁𝗵𝗲 𝘀𝗲𝗮𝗿𝗰𝗵 𝗳𝗼𝗿 𝗮𝗹𝗶𝗲𝗻 𝗹𝗶𝗳𝗲, ‏‏‎ ‎

𝗜𝗻 𝘁𝗵𝗲 𝘀𝗲𝗮𝗿𝗰𝗵 𝗳𝗼𝗿 𝗮𝗹𝗶𝗲𝗻 𝗹𝗶𝗳𝗲, 𝗳𝗶𝗻𝗱𝗶𝗻𝗴 𝗲𝘃𝗲𝗻 𝗮 𝘁𝗶𝗻𝘆 𝗺𝗶𝗰𝗿𝗼𝗯𝗲 𝘄𝗼𝘂𝗹𝗱 𝗯𝗲 𝗵𝗶𝘀𝘁𝗼𝗿𝗶𝗰.

𝗜𝗻 𝘁𝗵𝗲 𝘀𝗲𝗮𝗿𝗰𝗵 𝗳𝗼𝗿 𝗮𝗹𝗶𝗲𝗻 𝗹𝗶𝗳𝗲, ‏‏‎ ‎

𝗜𝗻 𝘁𝗵𝗲 𝘀𝗲𝗮𝗿𝗰𝗵 𝗳𝗼𝗿 𝗮𝗹𝗶𝗲𝗻 𝗹𝗶𝗳𝗲, 𝗳𝗶𝗻𝗱𝗶𝗻𝗴 𝗲𝘃𝗲𝗻 𝗮 𝘁𝗶𝗻𝘆 𝗺𝗶𝗰𝗿𝗼𝗯𝗲 𝘄𝗼𝘂𝗹𝗱 𝗯𝗲 𝗵𝗶𝘀𝘁𝗼𝗿𝗶𝗰.

𝗜𝗻 𝘁𝗵𝗲 𝘀𝗲𝗮𝗿𝗰𝗵 𝗳𝗼𝗿 𝗮𝗹𝗶𝗲𝗻 𝗹𝗶𝗳𝗲, ‏‏‎ ‎

𝗜𝗻 𝘁𝗵𝗲 𝘀𝗲𝗮𝗿𝗰𝗵 𝗳𝗼𝗿 𝗮𝗹𝗶𝗲𝗻 𝗹𝗶𝗳𝗲, 𝗳𝗶𝗻𝗱𝗶𝗻𝗴 𝗲𝘃𝗲𝗻 𝗮 𝘁𝗶𝗻𝘆 𝗺𝗶𝗰𝗿𝗼𝗯𝗲 𝘄𝗼𝘂𝗹𝗱 𝗯𝗲 𝗵𝗶𝘀𝘁𝗼𝗿𝗶𝗰.

𝗕𝘂𝘁 𝘄𝗲'𝗿𝗲 𝗻𝗼𝘁 𝗷𝘂𝘀𝘁 𝗹𝗼𝗼𝗸𝗶𝗻𝗴 𝗳𝗼𝗿 𝘁𝗶𝗻𝘆 𝗺𝗶𝗰𝗿𝗼𝗯𝗲𝘀.

𝗪𝗲'𝗿𝗲 𝗼𝗻 𝗮 𝘀𝗲𝗮𝗿𝗰𝗵 𝗳𝗼𝗿 𝗴𝗶𝗮𝗻𝘁𝘀.

𝗔𝗿𝗲 𝘁𝗵𝗲𝘆 𝗼𝘂𝘁 𝘁𝗵𝗲𝗿𝗲?

𝗪𝗶𝗹𝗹 𝘄𝗲 𝗲𝘃𝗲𝗿 𝗺𝗮𝗸𝗲 𝗰𝗼𝗻𝘁𝗮𝗰𝘁?

𝗛𝗼𝘄 𝗽𝗼𝘄𝗲𝗿𝗳𝘂𝗹 𝗰𝗼𝘂𝗹𝗱 𝘁𝗵𝗲𝘆 𝗯𝗲?

𝗔𝗳𝘁𝗲𝗿 𝟲𝟬 𝘆𝗲𝗮𝗿𝘀 𝗼𝗳 𝘀𝗲𝗮𝗿𝗰𝗵𝗶𝗻𝗴, ‏‏‎ ‎

𝗔𝗳𝘁𝗲𝗿 𝟲𝟬 𝘆𝗲𝗮𝗿𝘀 𝗼𝗳 𝘀𝗲𝗮𝗿𝗰𝗵𝗶𝗻𝗴, 𝘁𝗵𝗲 𝗴𝗮𝗺𝗲 𝗶𝘀 𝗮𝗯𝗼𝘂𝘁 𝘁𝗼 𝗰𝗵𝗮𝗻𝗴𝗲.

𝗡𝗲𝘄 𝗿𝗲𝘀𝗲𝗮𝗿𝗰𝗵 𝗶𝘀 𝗿𝗲𝘃𝗲𝗮𝗹𝗶𝗻𝗴 𝘀𝘁𝘂𝗻𝗻𝗶𝗻𝗴 𝗽𝗼𝘀𝘀𝗶𝗯𝗶𝗹𝗶𝘁𝗶𝗲𝘀.

𝗙𝗿𝗼𝗺 𝘁𝗵𝗲 𝗽𝗹𝗮𝗻𝗲𝘁𝗮𝗿𝘆

𝘁𝗼 𝘁𝗵𝗲 𝗴𝗮𝗹𝗮𝗰𝘁𝗶𝗰

𝗮𝗻𝗱 𝗯𝗲𝘆𝗼𝗻𝗱.

𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀

L‏‏‎ ‎I‏‏‎ ‎F‏‏‎ ‎E‏‏‎ ‎

L‏‏‎ ‎I‏‏‎ ‎F‏‏‎ ‎E‏‏‎‏‏‎ ‎‏‏‎‎ ‎ B‏‏‎ ‎E‏‏‎ ‎Y‏‏‎ ‎O‏‏‎ ‎N‏‏‎ ‎D

𝐂𝐇𝐀𝐏𝐓𝐄𝐑 𝐈𝐈𝐈 ‏‏‎ ‎

𝐂𝐇𝐀𝐏𝐓𝐄𝐑 𝐈𝐈𝐈 ɪ‏‏‎ɴ ꜱ‎ᴇ‏‏‎ᴀ‏‏‎‎ʀ‏‏ᴄ‏‏ʜ‏‏‎ ᴏ‏‏‎ꜰ‏‏‎ ɢ‏‏‎‎ɪ‏‏‎ᴀ‏‏‎ɴ‎ᴛ‎ꜱ

[]

[ ]

[‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎]

[‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎] []

[‏‏‎ ‎0‏‏‎ ] []

[ ‎0‏‏‎ ] [ ]

[‏‏‎ ‎0‏‏‎ ‎‎] [‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎]

[‏‏‎ ‎0‏‏‎ ‎‎] [‏‏‎ ‎1‏‏‎ ‎‎]

[‏‏‎ ‎0‏‏‎ ‎‎] [‏‏‎ ‎1‏‏‎ ‎‎]

[‏‏‎ ‎0‏‏‎ ‎‎] [‏‏‎ ‎1‏‏‎ ‎‎] ‏‏‎ ‎

[‏‏‎ ‎0‏‏‎ ‎‎] [‏‏‎ ‎1‏‏‎ ‎‎] The most

[‏‏‎ ‎0‏‏‎ ‎‎] [‏‏‎ ‎1‏‏‎ ‎‎] ‏‏‎ ‎

[‏‏‎ ‎0‏‏‎ ‎‎] [‏‏‎ ‎1‏‏‎ ‎‎] common complex object known-

[‏‏‎ ‎0‏‏‎ ‎‎] [‏‏‎ ‎1‏‏‎ ‎‎] ..known in the universe

[‏‏‎ ‎0‏‏‎ ‎‎] [‏‏‎ ‎1‏‏‎ ‎‎] ..known in the universe

[‏‏‎ ‎0‏‏‎ ‎‎] [‏‏‎ ‎1‏‏‎ ‎‎] ..known in the universe

[‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎] [‏‏‎ ‎1‏‏‎ ‎‎] ..known in the universe

[‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎] [‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎] ..known in the universe

[‏‏‎ ‎] [‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎] ..known in the universe

[‏‏‎ ‎] [‏‏‎ ‎] ..known in the universe

[‏‏‎‎] [‏‏‎ ‎] ..known in the universe

[‏‏‎‎] [‏‏‎‎] ‏‏‎‎..known in the universe

[‏‏‎‎] ‏‏‎‎..known in the universe

‏‏‎‎..known in the universe

‏‏‎‎..known in the universe ‏‏‎ ‎

..known in the universe - is the Human brain.

These..

86

86,000,000,000

86,000,000,000 neurons

have given us

have given us the power

to transform..

to transform our planet.

But is this-

..this the best nature

this the best nature can do?

We now know..

We now know.. 1

‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‏‏‎ ‎‎‏‏‎ ‎‏‏‎ ‎1

there're something like 10

there're something like 10,

there're something like 10,0

there're something like 10,00

there're something like 10,000

there're something like 10,000,

there're something like 10,000,0

there're something like 10,000,00

there're something like 10,000,000

there're something like 10,000,000,

there're something like 10,000,000,0

there're something like 10,000,000,00

there're something like 10,000,000,000

there're something like 10,000,000,000,

there're something like 10,000,000,000,0

there're something like 10,000,000,000,00

there're something like 10,000,000,000,000

there're something like 10,000,000,000,000,

there're something like 10,000,000,000,000,0

..something like 10,000,000,000,000,00

..something like 10,000,000,000,000,000

..something like 10,000,000,000,000,000,

..something like 10,000,000,000,000,000,0

..something like 10,000,000,000,000,000,00

..something like 10,000,000,000,000,000,000

..something like 10,000,000,000,000,000,000,

..something like 10,000,000,000,000,000,000,0 ‏‏‎ ‎

..something like 10,000,000,000,000,000,000,00 ‏‏‎ ‎

..something like 10,000,000,000,000,000,000,000 ‏‏‎ ‎

..something like 10,000,000,000,000,000,000,000 ‏‏‎ ‎

..something like 10,000,000,000,000,000,000,000 habitable planets

..something like 10,000,000,000,000,000,000,000 (sextillion) habitable planets

..something like 10,000,000,000,000,000,000,000 (sextillion) habitable planets in the universe.

10 billion-trillion (sextillion)..

10 billion-trillion (sextillion) chances

for the brain,

to be eclipsed

to be eclipsed by

to be eclipsed by something else.

The search for intelligent life..

is more

is more than just a

is more than just a scientific

is more than just a scientific curiosity.

Is driven

Is driven by a deep desire..

to connect

to connect with something

to connect with something greater.

Finding an Alien civilization..

wouldn't

wouldn't just reveal,

we're not alone;

it could chart

a new course

a new course of evolution

for our species.

And unlike primitive life,

Alien intelligence..

could be detectable

thousands

thousands of light-years

thousands of light-years away,

making them

making them potentially

easier to find.

What do they know

that we don't?

And how

And how do we make contact?

We're not..

We're not the first

We're not the first to wonder...

‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‏‏‎ ‎

𝗜. ‏ ‏‏‎ ‎‏‎

𝗜. 𝗠𝗘𝗦𝗦𝗘𝗡𝗚𝗘𝗥𝗦 ‏‏‎ ‎

𝗜. 𝗠𝗘𝗦𝗦𝗘𝗡𝗚𝗘𝗥𝗦 ʳᵉᵛᵉᵃˡᶦⁿᵍ ʷᵉ'ʳᵉ ⁿᵒᵗ ᵃˡᵒⁿᵉ

2

200

200 years ago

we dreamed of lighting-

..lighting huge rings of fire

in the Sahara Desert

to signal

to signal our presence.

And in the

And in the 18

And in the 1860s,

a French poet-

..poet proposed

proposed a patchwork

of

of giant

of giant mirrors,

reflecting

reflecting sunlight

reflecting sunlight to Mars..

in the form

of The

of The Big Dipper.

But if you want

to send a signal..

across an Ocean

an Ocean of space

an Ocean of space ‏‏‎ ‎

an Ocean of space - ‏‏‎ ‎

an Ocean of space - Bonfires

Bonfires and

and reflected-sunlight

won't help you much.

Even

Even a nuclear war

on a

on a nearby

on a nearby planet,

would be..

would be virtually

be virtually impossible-

..impossible to detect

with current technology.

To really

To really get your message

To really get your message across,

you need

a form

a form of light

you can't even see

- Radio-waves

are ideal..

ideal for carrying information

long distance,

because compared

to other

to other forms of light,

they travel..

travel more freely

through interstellar-gas and dust.

That's why

That's why SETI

That's why SETI ‏‏‎ ‎

That's why SETI - The Search for Extraterrestrial Intelligence,

- The Search for Extraterrestrial Intelligence,

has focused

has focused almost..

entirely

on scanning

for radio signals,

whether

whether intentional messages,

or

or byproducts..

byproducts of technology.

Our own radio-transmissions

have now traveled..

1

100 light-years

and reached..

reached 7

reached 75

reached 75 star systems,

some of which

include

include potentially

include potentially habitable planets.

And if Alien intelligence

Alien intelligence Lies Beyond-

..Beyond this Bubble of signals,

they could

could still infer life

on Earth

by

by spotting Oxygen

in our atmosphere.

Thanks

Thanks to the SETI Institute,

and the..

and the recent 'Breakthrough..

'Breakthrough Listen' project.

We have now

scanned,

scanned, tens

scanned, tens of millions-

..tens of millions of stars

for signals.

But despite

despite all this

after

after 6-decades

after 6-decades of searching

after 6-decades of searching..

after 6-decades of searching‏‏‎ ‎‏‏‎ ‎

after 6-decades of searching - Nothing

,only

,only a series

of..

of false alarms

and

and dead-end leads

,we call it

- The

- The Great

- The Great Silence

But

But in reality..

the search

the search has barely

barely even begun.

There are

There are 2

There are 2,000,000,000,000

2,000,000,000,000 other galaxies out there

that

that are still

that are still too far away

for practical study.

If space

or the size

of all Earths-oceans,

we would've

we would've searched

searched less than..

less than a Pools-worth of Water

for signs-

for signs of intelligent life.

On top

On top of this,

we might even be looking..

for the

for the wrong

for the wrong thing.

There's more than one-way

to

to communicate

to communicate across

to communicate across space.

In Alien life

might view

might view radio-

as primitive technology.

We have to

We have to consider

every..

every possible alternative.

From the..

From the Practical

to the..

to the Unimaginable.

The search

is now

is now underway..

for a

..different

..different type

..different type of signal.

One

we could

even spot

with the

with the naked eye

with the naked eye ‏‏‎ ‎

with the naked eye - ‏‏‎ ‎

with the naked eye - Laser light

with the naked eye - Laser light,

[]

[ ‏‎]

[ ‏ ‏ ‏]

[ ‏‎2‏‏‎ ‏‎‎]

[ ‏‎2‏‏‎ ‏‎‎]

[ ‏‎2‏‏‎ ‏‎‎] ‏‏‎ ‎

[ ‏‎2‏‏‎ ‏‎‎] high-powered laser bursts

[ ‏‎2‏‏‎ ‏‎‎] ‏‏‎ ‎

[ ‏‎2‏‏‎ ‏‎‎] can outshine

[ ‏‎2‏‏‎ ‏‎‎] can outshine

[ ‏ ‏ ‏] can outshine

[ ‏‎] can outshine

[‏‏‎‏‏‎‏‏‎]

..a star

by

by thousands

by thousands of times.

And can carry-

..carry far more

carry far more DPS

carry far more DPS than radio

We would..

We would have to be

in direct-line of sight,

to detect

to detect the beam.

But

spread across

across many light-years,

they would widen

widen to encompass..

entire planets and moons.

Fleets of laser beacons

could be used-

..used to sweep

sweep the entire galaxy.

Like Alien Lighthouses,

in a Cosmic Sea.

Thanks..

Thanks to a recent

recent crowdfunding effort,

plans are now

now in motion

to monitor

the

the entire

the entire night sky

for laser pulses.

But while

But while these

But while these bright flashes

would be

would be relatively easy to find,

advanced life

might be using-

..using something

..using something far more elusive

..using something far more elusive ‏‏‎ ‎

..using something far more elusive - Neutrinos,

tiny

tiny subatomic particles

that are streaming through you,

by the

the trillions every second.

These ghosts particles,

can pass through

pass through entire planets,

and not

and not touch

and not touch a single

and not touch a single atom.

It takes

It takes a giant room..

𝐒 ᴍ ‏‏‎ ‎

𝐒𝐔 ᴍᴏ ‏‏‎ ‎

𝐒𝐔𝐏 ᴍᴏᴜ ‏‏‎ ‎

𝐒𝐔𝐏𝐄 ᴍᴏᴜɴ ‏‏‎ ‎

𝐒𝐔𝐏𝐄𝐑 ᴍᴏᴜɴᴛ like this,

𝐒𝐔𝐏𝐄𝐑- ᴍᴏᴜɴᴛ like this,

𝐒𝐔𝐏𝐄𝐑-𝐊 ᴍᴏᴜɴᴛ ɪ like this,

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀 ᴍᴏᴜɴᴛ ɪᴋ like this,

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌 ᴍᴏᴜɴᴛ ɪᴋᴇ like this,

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈 ᴍᴏᴜɴᴛ ɪᴋᴇɴ like this,

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ like this,

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, like this,

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, like this,

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊ like this,

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊᴀ like this,

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊᴀᴘ like this,

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊᴀᴘᴀ like this,

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃𝐄 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊᴀᴘᴀɴ like this,

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃𝐄𝐓 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊᴀᴘᴀɴ like this,

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃𝐄𝐓𝐄 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊᴀᴘᴀɴ like this,

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃𝐄𝐓𝐄𝐂 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊᴀᴘᴀɴ like this,

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃𝐄𝐓𝐄𝐂𝐓 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊᴀᴘᴀɴ ‏‏‎ ‎

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃𝐄𝐓𝐄𝐂𝐓𝐎 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊᴀᴘᴀɴ ‏‏‎ ‎

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃𝐄𝐓𝐄𝐂𝐓𝐎𝐑 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊᴀᴘᴀɴ ‏‏‎ ‎

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃𝐄𝐓𝐄𝐂𝐓𝐎𝐑 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊᴀᴘᴀɴ to detect

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃𝐄𝐓𝐄𝐂𝐓𝐎𝐑 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊᴀᴘᴀɴ just a

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃𝐄𝐓𝐄𝐂𝐓𝐎𝐑 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊᴀᴘᴀɴ just a handful of them,

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃𝐄𝐓𝐄𝐂𝐓𝐎𝐑 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊᴀᴘᴀɴ just a handful of them, per day.

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃𝐄𝐓𝐄𝐂𝐓𝐎𝐑 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊᴀᴘᴀɴ

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃𝐄𝐓𝐄𝐂𝐓𝐎 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊᴀᴘᴀ

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃𝐄𝐓𝐄𝐂𝐓 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊᴀᴘ

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃𝐄𝐓𝐄𝐂 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊᴀ

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃𝐄𝐓𝐄 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊ

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃𝐄𝐓 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ,

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃𝐄 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ,

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 ᴍᴏᴜɴᴛ ɪᴋᴇɴ

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 ᴍᴏᴜɴᴛ ɪᴋᴇ

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃 ᴍᴏᴜɴᴛ ɪᴋ

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍 ᴍᴏᴜɴᴛ ɪ

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀 ᴍᴏᴜɴᴛ

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊 ᴍᴏᴜɴᴛ

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎 ᴍᴏᴜɴ

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈 ᴍᴏᴜ

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌 ᴍᴏ

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀 ᴍ

𝐒𝐔𝐏𝐄𝐑-𝐊

𝐒𝐔𝐏𝐄𝐑-

𝐒𝐔𝐏𝐄𝐑

𝐒𝐔𝐏𝐄

𝐒𝐔𝐏

𝐒𝐔

𝐒

But researchers

researchers recently proved..

neutrino communication.

neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁ Department of Electrical and Computer Engineering, North Carolina State University, Raleigh, NC 27695 - D.D. Stancil₁ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁ Department of Electrical and Computer Engineering, North Carolina State University, Raleigh, NC 27695 - B.L. Hughes₁ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂ Fermi National Accelerator Laboratory, Batavia, IL 60510 - P. Adamson₂ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂ Fermi National Accelerator Laboratory, Batavia, IL 60510 - M. Andrews₂ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂ Fermi National Accelerator Laboratory, Batavia, IL 60510 - L. Bagby₂ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂ Fermi National Accelerator Laboratory, Batavia, IL 60510 - D. Boehnlein₂ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂ Fermi National Accelerator Laboratory, Batavia, IL 60510 - D.P. Capista₂ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂ Fermi National Accelerator Laboratory, Batavia, IL 60510 - T. Griffin₂ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂ Fermi National Accelerator Laboratory, Batavia, IL 60510 - E. Hahn₂ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂ Fermi National Accelerator Laboratory, Batavia, IL 60510 - D.A. Harris₂ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂ Fermi National Accelerator Laboratory, Batavia, IL 60510 - K. Kephart₂ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂ Fermi National Accelerator Laboratory, Batavia, IL 60510 - J. Kilmer₂ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂ Fermi National Accelerator Laboratory, Batavia, IL 60510 - K.S. McFarland₅'₂ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂ Fermi National Accelerator Laboratory, Batavia, IL 60510 - J.G. Morffin₂ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂ Fermi National Accelerator Laboratory, Batavia, IL 60510 - J. Osta₂ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂ Fermi National Accelerator Laboratory, Batavia, IL 60510 - A. Pla-Dalmau₂ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂ Fermi National Accelerator Laboratory, Batavia, IL 60510 - P. Rubinov₂ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂ Fermi National Accelerator Laboratory, Batavia, IL 60510 - D.W. Schmitz₂ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂ Fermi National Accelerator Laboratory, Batavia, IL 60510 - R. Stefanski₂ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂ Fermi National Accelerator Laboratory, Batavia, IL 60510 - J. Voirin₂ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₃ Universidad Nacional de Ingenieria, Av. Tupac Amaru 210. Lima. Peru - M. Alania₃ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₃ Universidad Nacional de Ingenieria, Av. Tupac Amaru 210. Lima. Peru - A. Chamorro₃ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₃ Universidad Nacional de Ingenieria, Av. Tupac Amaru 210. Lima. Peru - K. Hurtado₃ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₄ Sección Fisica, Departamento de Ciencias, Pontificia Univerndad Católica del Peru, Apartado 1761. Lima Peru - L. Aliaga₄ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₄ Sección Fisica, Departamento de Ciencias, Pontificia Univerndad Católica del Peru, Apartado 1761. Lima Peru - C. Araujo Del Castillo₄ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₄ Sección Fisica, Departamento de Ciencias, Pontificia Univerndad Católica del Peru, Apartado 1761. Lima Peru - J.L. Bazo Alba₄ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₄ Sección Fisica, Departamento de Ciencias, Pontificia Univerndad Católica del Peru, Apartado 1761. Lima Peru - A.M. Gago₄ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₄ Sección Fisica, Departamento de Ciencias, Pontificia Univerndad Católica del Peru, Apartado 1761. Lima Peru - N. Ochoa₄ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₄ Sección Fisica, Departamento de Ciencias, Pontificia Univerndad Católica del Peru, Apartado 1761. Lima Peru - C.E. Pérez Lara₄ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₄ Sección Fisica, Departamento de Ciencias, Pontificia Univerndad Católica del Peru, Apartado 1761. Lima Peru - J.P Velàsquez₄ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - A. Bodek₅ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - R. Bradford₅ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - H. Budd₅ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - J.Chvojka₅ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - P.D Conrow₅ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - M. Day₅ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - J. Griffin₅ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - C.M. Hoffman₅ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - A. Judd₅ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - H. Lee₅ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - L. Loiacono₅'₁₉ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - S.Manly₅ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - C.M. Marshall₅ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - K.S. McFarland₅'₂ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - A. Mislivec₅ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - A. M. McGowan₅ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - J.A. Niemiee-Gielata₅ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - J.S. Paradis₅ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - J. Park₅ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - G. Perdue₅ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - D. Ruggiero₅ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - J. Wolcott₅ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₆ Departamento de Fisica, Universidad Técnica Federico Santa María, Avda. España 1680 Casilla 110-V Valparaíco, Chile - W.K. Brooks ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₆ Departamento de Fisica, Universidad Técnica Federico Santa María, Avda. España 1680 Casilla 110-V Valparaíco, Chile - G. Maggi₆ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₆ Departamento de Fisica, Universidad Técnica Federico Santa María, Avda. España 1680 Casilla 110-V Valparaíco, Chile - C. Peña₆ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₆ Departamento de Fisica, Universidad Técnica Federico Santa María, Avda. España 1680 Casilla 110-V Valparaíco, Chile - F. Prokoshin₆ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₇ Institute for Nuclear Research of the Russian Academy of Sciences, 117312 Moscow, Russia - A. Butkevich₇ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₇ Institute for Nuclear Research of the Russian Academy of Sciences, 117312 Moscow, Russia - S.A. Kulagin₇ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₈ Centro Brasileiro de Pesquisas Flsicas, Rua Dr. Xavier Sigaud 150, Urca, Rio de Janeiro, RJ, 22190-180, Brazil - D.A.M. Caicedo₈ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₈ Centro Brasileiro de Pesquisas Flsicas, Rua Dr. Xavier Sigaud 150, Urca, Rio de Janeiro, RJ, 22190-180, Brazil - C.M. Castromonte₈ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₈ Centro Brasileiro de Pesquisas Flsicas, Rua Dr. Xavier Sigaud 150, Urca, Rio de Janeiro, RJ, 22190-180, Brazil - G.A. Fiorentini₈ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₈ Centro Brasileiro de Pesquisas Flsicas, Rua Dr. Xavier Sigaud 150, Urca, Rio de Janeiro, RJ, 22190-180, Brazil - H. da Motta₈ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₈ Centro Brasileiro de Pesquisas Flsicas, Rua Dr. Xavier Sigaud 150, Urca, Rio de Janeiro, RJ, 22190-180, Brazil - J.L. Palomino₈ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₉ Department of Physics, College of Wlliam & Mary, Williamsburg. VA 23187 - E. Charlton₉ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₉ Department of Physics, College of Wlliam & Mary, Williamsburg. VA 23187 - J Devan₉ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₉ Department of Physics, College of Wlliam & Mary, Williamsburg. VA 23187 - M. Kordosky₉ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₉ Department of Physics, College of Wlliam & Mary, Williamsburg. VA 23187 - J.K. Nelson₉ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₉ Department of Physics, College of Wlliam & Mary, Williamsburg. VA 23187 - B. Pollock₉ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₉ Department of Physics, College of Wlliam & Mary, Williamsburg. VA 23187 - J. Walding₉ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₉ Department of Physics, College of Wlliam & Mary, Williamsburg. VA 23187 - D. Zhang₉ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₀ Hampton University, Dept. of Physics, Hampton, VA 23668 - M.E. Christy₁₀ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₀ Hampton University, Dept. of Physics, Hampton, VA 23668 - T. Walton₁₀ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₀ Hampton University, Dept. of Physics, Hampton, VA 23668 - L.Y. Zhu₁₀ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₁ Department of Physics and Astronomy, University of Pittsburgh, Pittsburgh PA 15260 - J.Danko₁₁ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₁ Department of Physics and Astronomy, University of Pittsburgh, Pittsburgh PA 15260 - S.A. Dytman₁₁ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₁ Department of Physics and Astronomy, University of Pittsburgh, Pittsburgh PA 15260 - B. Eberly₁₁ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₁ Department of Physics and Astronomy, University of Pittsburgh, Pittsburgh PA 15260 - J.R. Fein₁₁ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₁ Department of Physics and Astronomy, University of Pittsburgh, Pittsburgh PA 15260 - V. Paolone₁₁ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₂ NASA Glenn Research Center, Clevcland OH 44135 - J.M. Downey₁₂ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₂ NASA Glenn Research Center, Clevcland OH 44135 - O.S. Sands₁₂ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₃ Departamento de Fisica, Universidad de Guanajuato, Campus León, Lomas del Bosque 103 - J. Felix₁₃ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₃ Departamento de Fisica, Universidad de Guanajuato, Campus León, Lomas del Bosque 103 - A. Higuera₁₃ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₃ Departamento de Fisica, Universidad de Guanajuato, Campus León, Lomas del Bosque 103 - G. Zavala₁₃ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₄ fracc. Lomas del Campestre León GTO. 37150, México - L. Fields₁₄ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₄ fracc. Lomas del Campestre León GTO. 37150, México - J.A. Hobbs₁₄ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₄ fracc. Lomas del Campestre León GTO. 37150, México - V.A. Kuznetsov₁₄ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₄ fracc. Lomas del Campestre León GTO. 37150, México - A.M. Peterman₁₄ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₄ fracc. Lomas del Campestre León GTO. 37150, México - H. Schellman₁₄ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₄ fracc. Lomas del Campestre León GTO. 37150, México - R.N TIlden₁₄ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₄ fracc. Lomas del Campestre León GTO. 37150, México - B.J. Walker₁₄ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₄ fracc. Lomas del Campestre León GTO. 37150, México - T.P. Wytock₁₄ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₅ Northwestern University, Evanston, IL 60208 - H. Gallagher₁₅ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₅ Northwestern University, Evanston, IL 60208 - T. Kafka₁₅ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₅ Northwestern University, Evanston, IL 60208 - W.A. Mann₁₅ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₆ Physics Department, Tutfs Univervily, Medford, MA 02155 - R. Gran₁₆ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₆ Physics Department, Tutfs Univervily, Medford, MA 02155 - M. Lanari₁₆ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₇ Department of Physics, University of Minnesota - Duluth, Duluth, MN 55812 - J. Grange₁₇ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₇ Department of Physics, University of Minnesota - Duluth, Duluth, MN 55812 - J. Mousseau₁₇ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₇ Department of Physics, University of Minnesota - Duluth, Duluth, MN 55812 - B. Osmanov₁₇ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₇ Department of Physics, University of Minnesota - Duluth, Duluth, MN 55812 - H. Ray₁₇ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₈ Rutgers, The State University of New Jersey, Piscataway, NJ 08854 - T. Le₁₈ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₈ Rutgers, The State University of New Jersey, Piscataway, NJ 08854 - R.D. Ransome₁₈ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₈ Rutgers, The State University of New Jersey, Piscataway, NJ 08854 - M. Reyhan₁₈ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₈ Rutgers, The State University of New Jersey, Piscataway, NJ 08854 - E.C. Schulte₁₈ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₈ Rutgers, The State University of New Jersey, Piscataway, NJ 08854 - V.Takhistov₁₈ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₈ Rutgers, The State University of New Jersey, Piscataway, NJ 08854 - B.G. Tice₁₈ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₈ Rutgers, The State University of New Jersey, Piscataway, NJ 08854 - I. Vergalosova₁₈ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₉ Department of Physics, University of Texas, 1 University Station, Austin, TX 78712 - L. Loiacono₅'₁₉ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₉ Department of Physics, University of Texas, 1 University Station, Austin, TX 78712 - R.G. Stevens₁₉ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂₀ Massachusetts College of Liberal Arts, 375 Church St., North Adams, MA 01247 - E. Maher₂₀ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂₁ Department of Physics and Astronomy, Universily of California, Irvine, Irvine, CA 92697-4575 - C. Simon₂₁ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂₁ Department of Physics and Astronomy, Universily of California, Irvine, Irvine, CA 92697-4575 - B.P. Ziemer₂₁ ‏‏‎ ‎ neutrino communication. Is possible,

𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 and ₂₂ Otterbein College, One Otterbein College, Westerville, OH, 43081 - and N. Tagg₂₂ ‏‏‎ ‎ neutrino communication. Is possible,

neutrino communication. Is possible,

by sending

sending a simple message

through

through 2

through 240

through 240 meters

of rock.

-‏‏‎‏‏‎ ( T ) ‏‏‎ ‎

-.‏‏‎‏‏‎ ( N ) ‏‏‎ ‎

-.‏‏‎ ‎ . ( NE ) ‏‏‎ ‎

-.‏‏‎ ‎ .‏‏‎ ‎ . ( NEE ) ‏‏‎ ‎

-.‏‏‎ ‎ .‏‏‎ ‎ .. ( NEI ) ‏‏‎ ‎

-.‏‏‎ ‎ .‏‏‎ ‎ ..- ( NEU ) ‏‏‎ ‎

-.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ - ( NEUT ) ‏‏‎ ‎

-.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ . ( NEUTE ) ‏‏‎ ‎

-.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .- ( NEUTA ) ‏‏‎ ‎

-.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .-. ( NEUTR ) ‏‏‎ ‎

-.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .-.‏‏‎ ‎ . ( NEUTRE ) If advanced life..

-.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .-.‏‏‎ ‎ .. ( NEUTRI ) If advanced life..

-.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .-.‏‏‎ ‎ ..‏‏‎ ‎ - ( NEUTRIT ) If advanced life..

-.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .-.‏‏‎ ‎ ..‏‏‎ ‎ -. ( NEUTRIN ) If advanced life..

-.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .-.‏‏‎ ‎ ..‏‏‎ ‎ -.‏‏‎ ‎ - ( NEUTRINT ) If advanced life..

-.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .-.‏‏‎ ‎ ..‏‏‎ ‎ -.‏‏‎ ‎ -- ( NEUTRINM ) If advanced life..

-.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .-.‏‏‎ ‎ ..‏‏‎ ‎ -.‏‏‎ ‎ --- ( NEUTRINO ) If advanced life..

-.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .-.‏‏‎ ‎ ..‏‏‎ ‎ -.‏‏‎ ‎ --- ( NEUTRINO ) ‏‏‎ ‎

-.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .-.‏‏‎ ‎ ..‏‏‎ ‎ -.‏‏‎ ‎ --- ( NEUTRINO ) is using them

-.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .-.‏‏‎ ‎ ..‏‏‎ ‎ -.‏‏‎ ‎ --- ( NEUTRINo ) is using them

-.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .-.‏‏‎ ‎ ..‏‏‎ ‎ -.‏‏‎ ‎ --- ( NEUTRIno ) is using them

-.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .-.‏‏‎ ‎ ..‏‏‎ ‎ -.‏‏‎ ‎ --- ( NEUTRino ) is using them

-.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .-.‏‏‎ ‎ ..‏‏‎ ‎ -.‏‏‎ ‎ --- ( NEUTrino ) is using them

-.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .-.‏‏‎ ‎ ..‏‏‎ ‎ -.‏‏‎ ‎ --- ( NEUtrino ) is using them

-.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .-.‏‏‎ ‎ ..‏‏‎ ‎ -.‏‏‎ ‎ --- ( NEutrino ) is using them

-.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .-.‏‏‎ ‎ ..‏‏‎ ‎ -.‏‏‎ ‎ --- ( Neutrino ) is using them

-.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .-.‏‏‎ ‎ ..‏‏‎ ‎ -.‏‏‎ ‎ --- ( Neutrino ) is using them to communicate,

their signals

signals could travel

travel anywhere,

through

through any obstacle

at the

at the speed

at the speed of light.

Their messages

could be

could be streaming through us-

..streaming through us right now,

and we..

would have no

would have no idea

; or maybe

; or maybe intelligent life

is taking..

an entirely different approach

different approach to communication -

Using space-time itself

as a medium.

By manipulating

high

high-gravity objects,

they could

they could in theory

create pattern distortions-

of space-time,

which could ripple

ripple through

ripple through the universe,

in all directions.

But making

making gravity waves,

strong enough

enough to be detectable

would be

would be extremely

would be extremely energy intensive.

Maybe

Maybe they're up to

something far simpler -

Placing giant sunshades

sunshades into orbit around a star

could block out starlight

in distinct patterns,

like a kind

kind of cosmic Morse code.

And

And even though

it might take

might take years

to blink out

to blink out a basic message.

A system like this,

would require

require little effort

require little effort to sustain.

But the most-

..the most sci-fi possibility of all,

is that

is that they have left

messages

messages in our DNA.

Some have proposed..

that certain

certain sequences of our genes

AGCTCTCGCAGCTAGCTGACTGACGC

GGCTGACGCGTACGCGCTAGCACGAT

TGCTCGACGTGACTTTGAACGTCTCGC

GCAGGACGCTGACGCTAGCGTCCTAGC

AGTCGACGCAGCGCTAGCGACGACTGG

TGCTGACTACTTTCCGACTGACGCAGCG

GACTGCATGACTGCTAGGTCAGCTGCAC

GTGTCAGTCCCTCGGTGATGGATATGGC

could contain..

contain hidden messages.

GCCCATCGATGCTGATTAATGCGACTAC

CCCCGATCCCCATCGCGGAATTATATTA

GCACTGACGATGTACGTCAGTGCATGT

GCCCTTCCGACTCCTCGACCTATATTTT

GCAGTCCTCCCCCTGCGACTCCGCGCG

AGCTGACTCCCATCTCTATACGCTAGCG

CGACGCCTCCTCTAGAGCGACACTATCT

CAGCTGACTCCCTCCTAATATTAATTGCA

contain hidden messages.

Easter eggs

Easter eggs in our genetic code,

placed by

placed by a life-designing

life-designing higher intelligence.

But

But far-flung scenarios-

..scenarios like this,

are overshadowed

by a more

sobering possibility...

maybe

maybe we're

maybe we're just in the

maybe we're just in the wrong place,

at the

at the wrong time...

Using a detailed computer model

of our galaxy,

researchers

researchers have estimated

that intelligent life

was possibly

was possibly most concentrated..

4

4,000,000,000 years ago

and closer

to the center

to the center of the galaxy.

If true,

then we

would exist

would exist on the outskirts,

light-years away

and

and billions of years

too late

too late to a galactic

too late to a galactic Golden Age.

Maybe they were here

millions of years ago

witness

witness to a whole

witness to a whole different planet.

By now,

they might

might all be

all be long gone,

and we could be living

in a Galactic

in a Galactic Graveyard.

It may

It may not be their-

..their signals that we find

that we find one day,

but their relics.

As it turns out,

our chances

of finding an Alien civilization,

depend heavily

on their average

their average survival time.

If the average lifetime

is something

is something like

like 100 years,

then they

they will

will blip in

and out of existence,

rarely overlapping

and our chances

chances of finding one alive

finding one alive are slim.

But if they

they survive for thousands

of years or more,

then our chances

chances will Skyrocket,

as the potential

for overlap expands.

But what if

they're not communicating at all?

...there's still

still a way-

we could find them...

‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‏‏‎ ‎

𝗜𝗜. ‏‏‎ ‎ ‏‏‎ ‎

𝗜𝗜. 𝗘𝗡𝗚𝗜𝗡𝗘𝗘𝗥𝗦 ‏‏‎ ‎

𝗜𝗜. 𝗘𝗡𝗚𝗜𝗡𝗘𝗘𝗥𝗦 ᶦⁿ ˢᵉᵃʳᶜʰ ᵒᶠ ᵍᶦᵃⁿᵗˢ

We tend to assume..

that Alien intelligence

would share

our motivation

our motivation to communicate.

But they

But they may find

But they may find the prospect

of making

of making contact

making contact too dangerous

or

or too futile.

If

If this

If this is the case,

then we have

we have to get

to get more creative

in our search.

In

In 20

In 2015,

astronomers

astronomers watched

watched as this normal-seeming star

began to

began to dim

and erratic waves,

unlike anything they'd

they'd seen before.

they'd seen before.

they'd seen before.

they'd seen before.

they'd seen before.

The cause

cause is probably

a giant dust cloud,

or

or a shattered moon

blocking the light,

but it has

all the

all the hallmarks

of something else

of something else -

of something else - ‏‏‎ ‎

of something else - An Alien

of something else - An Alien mega-structure.

And even though

this explanation

explanation looks unlikely,

it hints

it hints at a new way

finding intelligent life.

Not listening

Not listening for signals,

but looking

but looking for their

looking for their technology directly

; not

; not searching for

; not searching for messengers,

but searching

but searching for engineers.

And to do that,

we have to wonder -

what mind-boggling Alien technology,

should we

should we be looking for?

Each

Each Alien civilization

would be

would be wildly different,

but

but classifying them

by their

by their energy usage,

will give us

give us insights

into what technology..

they might be using

- the

- the Kardashev Scale

- the Kardashev Scale ‏‏‎ ‎

- the Kardashev Scale divides them..

- the Kardashev Scale divides them into 3 levels...

Type

Type One:

Type One: ‏‏‎ ‎

Type One: would have

Type One: would have a mastery

Type One: of their home planet,

Type One: ‏‏‎ ‎

‎Type One: using all the energy..

‎Type One: using all the energy available on it.

‎Type One: using all the energy available on it. ‏‏‎ ‎

‎Type One: using all the energy available on it. ‎Type Two:

‎Type One: using all the energy available on it. ‎Type Two:

‎Type One: using all the energy available on it. ‎Type Two:

‎Type One: using all the energy available on it. ‎Type Two:

‎Type One: using all the energy available on it. ‎Type Two:

‎Type One: using all the energy available on it. ‎Type Two:

‎Type One: using all the energy available on it. ‎Type Two:

‎Type One: using all the energy available on it. ‎Type Two: ‏‏‎ ‎

‎Type One: using all the energy available on it. ‎Type Two: Type Two,

‎Type One: using all the energy available on it. ‎Type Two: ‏‏‎ ‎

‎Type One: using all the energy available on it. ‎Type Two: would have mastery

‎Type One: using all the energy available on it. ‎Type Two: over their star,

‎Type One: using all the energy available on it. ‎Type Two: ‏‏‎ ‎

‎Type One: using all the energy available on it. ‎Type Two: harnessing all-

‎Type One: using all the energy available on it. ‎Type Two: harnessing all its solar energy.